ID: 966236131_966236137

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 966236131 966236137
Species Human (GRCh38) Human (GRCh38)
Location 3:177703877-177703899 3:177703892-177703914
Sequence CCATCTCGCCTGCAACTGCCCCC CTGCCCCCAGGCCGGGTCATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 29, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!