ID: 966255696_966255704

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 966255696 966255704
Species Human (GRCh38) Human (GRCh38)
Location 3:177914422-177914444 3:177914469-177914491
Sequence CCTCACTTTCCAGACAGGGCGGC TGCCAGATGGGGCAGCAGCCAGG
Strand - +
Off-target summary {0: 10, 1: 115, 2: 2447, 3: 6594, 4: 10614} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!