ID: 966305585_966305590

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 966305585 966305590
Species Human (GRCh38) Human (GRCh38)
Location 3:178530324-178530346 3:178530375-178530397
Sequence CCTAATTGTGATAAAGAGAGACG GACCCAAATCGTGGTCGTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 174} {0: 1, 1: 0, 2: 0, 3: 1, 4: 15}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!