ID: 966564429_966564433

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 966564429 966564433
Species Human (GRCh38) Human (GRCh38)
Location 3:181360718-181360740 3:181360760-181360782
Sequence CCAGCCTGGGCAACAAGAGTGAA AAGAAGAAGAAGAAGAAGGAAGG
Strand - +
Off-target summary {0: 11753, 1: 22317, 2: 29357, 3: 23571, 4: 20346} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!