|
Left Crispr |
Right Crispr |
Crispr ID |
966564429 |
966564433 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:181360718-181360740
|
3:181360760-181360782
|
Sequence |
CCAGCCTGGGCAACAAGAGTGAA |
AAGAAGAAGAAGAAGAAGGAAGG |
Strand |
- |
+ |
Off-target summary |
{0: 11753, 1: 22317, 2: 29357, 3: 23571, 4: 20346} |
{0: 10, 1: 198, 2: 474, 3: 1669, 4: 7148} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|