ID: 966564431_966564433

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 966564431 966564433
Species Human (GRCh38) Human (GRCh38)
Location 3:181360744-181360766 3:181360760-181360782
Sequence CCGTCTCAAAAAAAAGAAGAAGA AAGAAGAAGAAGAAGAAGGAAGG
Strand - +
Off-target summary {0: 33, 1: 450, 2: 7835, 3: 100787, 4: 85204} {0: 10, 1: 198, 2: 474, 3: 1669, 4: 7148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!