ID: 966665052_966665058

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 966665052 966665058
Species Human (GRCh38) Human (GRCh38)
Location 3:182463200-182463222 3:182463219-182463241
Sequence CCGCTCCACTCATGGCTGAAAGG AAGGGGCCAACATAGAGCTTGGG
Strand - +
Off-target summary No data {0: 58, 1: 243, 2: 464, 3: 870, 4: 1529}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!