ID: 966665052_966665060

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 966665052 966665060
Species Human (GRCh38) Human (GRCh38)
Location 3:182463200-182463222 3:182463225-182463247
Sequence CCGCTCCACTCATGGCTGAAAGG CCAACATAGAGCTTGGGCCATGG
Strand - +
Off-target summary No data {0: 19, 1: 55, 2: 160, 3: 349, 4: 650}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!