ID: 966665052_966665061

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 966665052 966665061
Species Human (GRCh38) Human (GRCh38)
Location 3:182463200-182463222 3:182463234-182463256
Sequence CCGCTCCACTCATGGCTGAAAGG AGCTTGGGCCATGGCTTCAGAGG
Strand - +
Off-target summary No data {0: 104, 1: 314, 2: 756, 3: 1216, 4: 1535}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!