ID: 966665052_966665062

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 966665052 966665062
Species Human (GRCh38) Human (GRCh38)
Location 3:182463200-182463222 3:182463235-182463257
Sequence CCGCTCCACTCATGGCTGAAAGG GCTTGGGCCATGGCTTCAGAGGG
Strand - +
Off-target summary No data {0: 110, 1: 317, 2: 720, 3: 1144, 4: 1940}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!