ID: 966693694_966693701

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 966693694 966693701
Species Human (GRCh38) Human (GRCh38)
Location 3:182767531-182767553 3:182767546-182767568
Sequence CCACCCACCTTGGCCTCCCAAAG TCCCAAAGTGTTGGGATTACAGG
Strand - +
Off-target summary {0: 21198, 1: 71365, 2: 150513, 3: 157804, 4: 132965} {0: 21407, 1: 311432, 2: 256151, 3: 138115, 4: 123943}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!