ID: 966693695_966693704

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 966693695 966693704
Species Human (GRCh38) Human (GRCh38)
Location 3:182767534-182767556 3:182767565-182767587
Sequence CCCACCTTGGCCTCCCAAAGTGT CAGGCATGAGCCACCGCGCCCGG
Strand - +
Off-target summary {0: 2536, 1: 40105, 2: 146028, 3: 241222, 4: 211356} {0: 7065, 1: 55609, 2: 120140, 3: 162711, 4: 170813}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!