ID: 966693695_966693707

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 966693695 966693707
Species Human (GRCh38) Human (GRCh38)
Location 3:182767534-182767556 3:182767578-182767600
Sequence CCCACCTTGGCCTCCCAAAGTGT CCGCGCCCGGCCTATGAAATAGG
Strand - +
Off-target summary {0: 2536, 1: 40105, 2: 146028, 3: 241222, 4: 211356} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!