ID: 966693698_966693707

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 966693698 966693707
Species Human (GRCh38) Human (GRCh38)
Location 3:182767538-182767560 3:182767578-182767600
Sequence CCTTGGCCTCCCAAAGTGTTGGG CCGCGCCCGGCCTATGAAATAGG
Strand - +
Off-target summary {0: 6346, 1: 95043, 2: 216067, 3: 233638, 4: 146425} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!