ID: 966693703_966693707

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 966693703 966693707
Species Human (GRCh38) Human (GRCh38)
Location 3:182767548-182767570 3:182767578-182767600
Sequence CCAAAGTGTTGGGATTACAGGCA CCGCGCCCGGCCTATGAAATAGG
Strand - +
Off-target summary {0: 7114, 1: 109335, 2: 242763, 3: 237820, 4: 206209} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!