ID: 966693703_966693711

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 966693703 966693711
Species Human (GRCh38) Human (GRCh38)
Location 3:182767548-182767570 3:182767597-182767619
Sequence CCAAAGTGTTGGGATTACAGGCA TAGGTACTCATTTTCAGTTAAGG
Strand - +
Off-target summary {0: 7114, 1: 109335, 2: 242763, 3: 237820, 4: 206209} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!