ID: 966705272_966705276

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 966705272 966705276
Species Human (GRCh38) Human (GRCh38)
Location 3:182906737-182906759 3:182906790-182906812
Sequence CCCACACCTGGCTCATAAATTTT AAGAAGAAGAAGAAGAAGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 277} {0: 13, 1: 55, 2: 313, 3: 900, 4: 3924}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!