ID: 966749722_966749730

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 966749722 966749730
Species Human (GRCh38) Human (GRCh38)
Location 3:183310460-183310482 3:183310509-183310531
Sequence CCATTGCACTCCAGCCTGGGCAA AAATTACCGGGTGTGATGGTGGG
Strand - +
Off-target summary {0: 36772, 1: 108043, 2: 179343, 3: 213379, 4: 164443} {0: 1, 1: 3, 2: 40, 3: 487, 4: 4937}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!