|
Left Crispr |
Right Crispr |
| Crispr ID |
966867762 |
966867774 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:184269694-184269716
|
3:184269735-184269757
|
| Sequence |
CCCTCAATTTTCCAGGCTAAAGT |
CCCTGAGTAGCTGGGACTACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 8, 3: 45, 4: 385} |
{0: 826, 1: 44844, 2: 164903, 3: 224557, 4: 209880} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|