ID: 967279248_967279257

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 967279248 967279257
Species Human (GRCh38) Human (GRCh38)
Location 3:187806275-187806297 3:187806303-187806325
Sequence CCTGACAATGTCTCCCACTGGCT CAGGGGAAGCCAGCTGATGTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!