ID: 967761107_967761110

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 967761107 967761110
Species Human (GRCh38) Human (GRCh38)
Location 3:193227274-193227296 3:193227303-193227325
Sequence CCTGCGTGGCAACCTGGGATTCA GAGGTGAGAAACCTGCTAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 9, 2: 21, 3: 47, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!