ID: 967832140_967832143

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 967832140 967832143
Species Human (GRCh38) Human (GRCh38)
Location 3:193928744-193928766 3:193928763-193928785
Sequence CCTGTTAGTTCTGTCCCTCTAGA TAGAGACCCCTGACTAATACAGG
Strand - +
Off-target summary {0: 77, 1: 755, 2: 1201, 3: 1045, 4: 1168} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!