ID: 967832141_967832149

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 967832141 967832149
Species Human (GRCh38) Human (GRCh38)
Location 3:193928758-193928780 3:193928775-193928797
Sequence CCCTCTAGAGACCCCTGACTAAT ACTAATACAGGTGGTCAGGAAGG
Strand - +
Off-target summary {0: 8, 1: 810, 2: 1148, 3: 816, 4: 629} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!