ID: 967896068_967896077

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 967896068 967896077
Species Human (GRCh38) Human (GRCh38)
Location 3:194397047-194397069 3:194397076-194397098
Sequence CCGGGGCAGAGCCCCAAACACGT GCAGGGTCTCCAGCTGGTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 105} {0: 1, 1: 0, 2: 2, 3: 20, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!