ID: 968054869_968054871

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 968054869 968054871
Species Human (GRCh38) Human (GRCh38)
Location 3:195683787-195683809 3:195683801-195683823
Sequence CCAGGGGCAACAGAAGAAGCCCT AGAAGCCCTTTGAGGTGCACTGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 1, 3: 19, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!