ID: 968076193_968076206

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 968076193 968076206
Species Human (GRCh38) Human (GRCh38)
Location 3:195817120-195817142 3:195817165-195817187
Sequence CCGGCCCGGCCTCCTTCTCCTTA CCGGCCTCCTTCTCCTTACCAGG
Strand - +
Off-target summary {0: 27, 1: 5, 2: 5, 3: 37, 4: 461} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!