ID: 968230798_968230804

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 968230798 968230804
Species Human (GRCh38) Human (GRCh38)
Location 3:197003478-197003500 3:197003499-197003521
Sequence CCCGAAGCCCGGGCCGCGGTGGC GCCGCCTCAGGCGCCCGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 173} {0: 1, 1: 0, 2: 0, 3: 12, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!