ID: 968372726_968372732

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 968372726 968372732
Species Human (GRCh38) Human (GRCh38)
Location 4:10863-10885 4:10892-10914
Sequence CCGGGGCGCAGGCGCAGAGACGG CCGCGGCGCAGGCGCAGAGACGG
Strand - +
Off-target summary No data {0: 9, 1: 4, 2: 13, 3: 25, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!