ID: 968453450_968453452

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 968453450 968453452
Species Human (GRCh38) Human (GRCh38)
Location 4:685900-685922 4:685922-685944
Sequence CCAGAGGGTTCGCTGGGTGGGCG GGATGCACAAAGTGTCAGCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 93} {0: 1, 1: 0, 2: 0, 3: 7, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!