ID: 968545141_968545149

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 968545141 968545149
Species Human (GRCh38) Human (GRCh38)
Location 4:1194451-1194473 4:1194480-1194502
Sequence CCCTGCAGGGGGAGTGGGAAGAA AAGCCGGGCCGCGGTAGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 372} {0: 1, 1: 0, 2: 0, 3: 3, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!