ID: 968551598_968551616

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 968551598 968551616
Species Human (GRCh38) Human (GRCh38)
Location 4:1226292-1226314 4:1226338-1226360
Sequence CCCACCCCATCCGGATGATTGCA GTCTCCCTGGGGAGGAGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 84} {0: 1, 1: 0, 2: 9, 3: 84, 4: 1273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!