ID: 968551601_968551620

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 968551601 968551620
Species Human (GRCh38) Human (GRCh38)
Location 4:1226297-1226319 4:1226343-1226365
Sequence CCCATCCGGATGATTGCATTCCT CCTGGGGAGGAGGAGGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 284} {0: 1, 1: 4, 2: 39, 3: 368, 4: 2868}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!