ID: 968551602_968551609

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 968551602 968551609
Species Human (GRCh38) Human (GRCh38)
Location 4:1226298-1226320 4:1226327-1226349
Sequence CCATCCGGATGATTGCATTCCTG ACTGGCCATCCGTCTCCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 105} {0: 1, 1: 0, 2: 0, 3: 9, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!