ID: 968551603_968551620

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 968551603 968551620
Species Human (GRCh38) Human (GRCh38)
Location 4:1226302-1226324 4:1226343-1226365
Sequence CCGGATGATTGCATTCCTGTGTC CCTGGGGAGGAGGAGGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 144} {0: 1, 1: 4, 2: 39, 3: 368, 4: 2868}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!