ID: 968669355_968669366

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 968669355 968669366
Species Human (GRCh38) Human (GRCh38)
Location 4:1840541-1840563 4:1840576-1840598
Sequence CCTGTAGTGCCAGCTACTCGGGA AGAATGGTGTGGACCCCGGGGGG
Strand - +
Off-target summary {0: 270, 1: 57609, 2: 183624, 3: 273771, 4: 189942} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!