ID: 968671894_968671904

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 968671894 968671904
Species Human (GRCh38) Human (GRCh38)
Location 4:1856393-1856415 4:1856425-1856447
Sequence CCCGTCGTACCGTGGACGCCGGG GTGGCGGCCGCAGGAGCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 15} {0: 1, 1: 0, 2: 1, 3: 32, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!