ID: 968671894_968671908

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 968671894 968671908
Species Human (GRCh38) Human (GRCh38)
Location 4:1856393-1856415 4:1856446-1856468
Sequence CCCGTCGTACCGTGGACGCCGGG GGAGTCGGCCGCGCTTGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 15} {0: 1, 1: 0, 2: 0, 3: 5, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!