ID: 968671898_968671909

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 968671898 968671909
Species Human (GRCh38) Human (GRCh38)
Location 4:1856402-1856424 4:1856447-1856469
Sequence CCGTGGACGCCGGGGCTCGCAGC GAGTCGGCCGCGCTTGCGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 86} {0: 1, 1: 0, 2: 2, 3: 3, 4: 40}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!