ID: 968673428_968673439

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 968673428 968673439
Species Human (GRCh38) Human (GRCh38)
Location 4:1864339-1864361 4:1864392-1864414
Sequence CCTGGGAGGCGGGGCAGCTTGAG ATCTGGCCTGGGACGGAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 23, 4: 372} {0: 1, 1: 0, 2: 2, 3: 15, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!