ID: 968673432_968673439

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 968673432 968673439
Species Human (GRCh38) Human (GRCh38)
Location 4:1864373-1864395 4:1864392-1864414
Sequence CCACTTGGAAGCCCTCTTTATCT ATCTGGCCTGGGACGGAGAAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!