ID: 968727361_968727370

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 968727361 968727370
Species Human (GRCh38) Human (GRCh38)
Location 4:2253957-2253979 4:2253990-2254012
Sequence CCCCAGGAACTGTGTAGGCAAGA TGCTCTCTCTGCTCAGGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 183} {0: 1, 1: 0, 2: 4, 3: 31, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!