ID: 968864570_968864573

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 968864570 968864573
Species Human (GRCh38) Human (GRCh38)
Location 4:3199739-3199761 4:3199761-3199783
Sequence CCGGAGAATCACAGCAGCTGCCA ACTAGGCTGTTCCGCAGTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 369} {0: 1, 1: 0, 2: 0, 3: 10, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!