ID: 968879467_968879472

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 968879467 968879472
Species Human (GRCh38) Human (GRCh38)
Location 4:3291924-3291946 4:3291964-3291986
Sequence CCTCCTGGGATCCAAACTAATCA GAGAGCTGCCAAGAAACCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 140} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!