ID: 968879469_968879482

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 968879469 968879482
Species Human (GRCh38) Human (GRCh38)
Location 4:3291935-3291957 4:3291983-3292005
Sequence CCAAACTAATCACACAAGACTAG TGGGGCGGTGGCGGGGACGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 14, 3: 336, 4: 1817}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!