ID: 968925453_968925461

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 968925453 968925461
Species Human (GRCh38) Human (GRCh38)
Location 4:3544882-3544904 4:3544927-3544949
Sequence CCTAGAGGCCAGGCAGAAGCAGC GGTGGCTGTGCGATTTCGTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 2, 3: 3, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!