ID: 968955653_968955666

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 968955653 968955666
Species Human (GRCh38) Human (GRCh38)
Location 4:3717527-3717549 4:3717570-3717592
Sequence CCTGCACCAACTAGAGTGGGGTC TGGGTGGAGGCCTGAGTGCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!