ID: 968993852_968993854

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 968993852 968993854
Species Human (GRCh38) Human (GRCh38)
Location 4:3933046-3933068 4:3933064-3933086
Sequence CCTGTTTGGTGGTCTCTTCACAC CACACGGACGTGCATGAAACTGG
Strand - +
Off-target summary {0: 1170, 1: 1149, 2: 398, 3: 94, 4: 130} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!