ID: 969004631_969004642

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 969004631 969004642
Species Human (GRCh38) Human (GRCh38)
Location 4:4009462-4009484 4:4009510-4009532
Sequence CCAGTGAGGGGGTCCATGTACTG GATTGCCCTGGACTGAGTACTGG
Strand - +
Off-target summary {0: 9, 1: 2, 2: 0, 3: 6, 4: 70} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!