ID: 969065942_969065944

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 969065942 969065944
Species Human (GRCh38) Human (GRCh38)
Location 4:4481119-4481141 4:4481132-4481154
Sequence CCCAAAGCACGATATACTGTACA ATACTGTACAACAAAAACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 73} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!