ID: 969080399_969080404

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 969080399 969080404
Species Human (GRCh38) Human (GRCh38)
Location 4:4613334-4613356 4:4613373-4613395
Sequence CCACACTGTTAGTGGTGGCAGAA AAAGTCCACCGGAACTGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 126} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!