ID: 969469189_969469198

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 969469189 969469198
Species Human (GRCh38) Human (GRCh38)
Location 4:7376941-7376963 4:7376972-7376994
Sequence CCCTGGCCTGCAGTCACGTGCAG CCGGCTCTGCACTGGGATTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 155} {0: 1, 1: 0, 2: 0, 3: 14, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!